Myog^em1.1Tajb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myog^em1.1Tajb
• Name: myogenin; endonuclease-mediated mutation 1.1, Shahragim Tajbakhsh
• MGI ID: MGI:7442679
• Synonyms: Myog^ntdTom
• Gene: Myog Location: Chr1:134217742-134220286 bp, + strand Genetic Position: Chr1, 58.18 cM
• Alliance: Myog^em1.1Tajb page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: Plasmids encoding gRNAs (CACCGCCCAACTGAGATTGTCTGTC and AAACGACAGACAATCTCAGTTGGGC) are designed to replace the stop codon of the gene with a viral T2A oligopeptide (T2A)-3xNLS-tdTomato cassette. An FRT-flanked neo cassette was included downstream. Flp-mediated recombination removed the neo cassette. (J:333832)

Expression

In Mice Carrying this Mutation:

31 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Myog Mutation: 12 strains or lines available

References

• Original: J:333832 Benavente-Diaz M, et al., Dynamics of myogenic differentiation using a novel Myogenin knock-in reporter mouse. Skelet Muscle. 2021 Feb 18;11(1):5
• All: 1 reference(s)