About   Help   FAQ
Myogem1.1Tajb
Endonuclease-mediated Allele Detail
Summary
Symbol: Myogem1.1Tajb
Name: myogenin; endonuclease-mediated mutation 1.1, Shahragim Tajbakhsh
MGI ID: MGI:7442679
Synonyms: MyogntdTom
Gene: Myog  Location: Chr1:134217742-134220286 bp, + strand  Genetic Position: Chr1, 58.18 cM
Alliance: Myogem1.1Tajb page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailsPlasmids encoding gRNAs (CACCGCCCAACTGAGATTGTCTGTC and AAACGACAGACAATCTCAGTTGGGC) are designed to replace the stop codon of the gene with a viral T2A oligopeptide (T2A)-3xNLS-tdTomato cassette. An FRT-flanked neo cassette was included downstream. Flp-mediated recombination removed the neo cassette. (J:333832)
Expression
In Mice Carrying this Mutation: 31 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Myog Mutation:  12 strains or lines available
References
Original:  J:333832 Benavente-Diaz M, et al., Dynamics of myogenic differentiation using a novel Myogenin knock-in reporter mouse. Skelet Muscle. 2021 Feb 18;11(1):5
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory