About   Help   FAQ
Rr385em1Srir
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr385em1Srir
Name: regulatory region 385; endonuclease-mediated mutation 1, Sridhar Rao
MGI ID: MGI:7439545
Synonyms: +60-enhancer-deleted
Gene: Rr385  Location: Chr6:122740988-122743850 bp  Genetic Position: Chr6, Syntenic
Alliance: Rr385em1Srir page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Nanog putative super-enhancer was targeted with sgRNAs (targeting ACCGTGGCTGCCGTATTATA and CTCGTTTGTAGCAAACAGCC) using CRISPR/Cas9, resulting in an ~10.5 kb deletion including the enhancer. (J:333571)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr385 Mutation:  0 strains or lines available
References
Original:  J:333571 Blinka S, et al., Super-Enhancers at the Nanog Locus Differentially Regulate Neighboring Pluripotency-Associated Genes. Cell Rep. 2016 Sep 27;17(1):19-28
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory