Trp53^em1Chrm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trp53^em1Chrm
• Name: transformation related protein 53; endonuclease-mediated mutation 1, Christine Mayr
• MGI ID: MGI:7438243
• Synonyms: Trp53-dUTR
• Gene: Trp53 Location: Chr11:69471185-69482699 bp, + strand Genetic Position: Chr11, 42.83 cM, cytoband B2-C
• Alliance: Trp53^em1Chrm page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: The 3' UTR was targeted with crRNAs (targeting GTGATGGGGACGGGATGCAG and CATAGGGTCCATATCCTCCA) and tracrRNA using CRISPR/Cas9 technology, resulting in a 295 bp deletion. (J:333414)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Trp53 Mutation: 237 strains or lines available

References

• Original: J:333414 Mitschka S, et al., Endogenous p53 expression in human and mouse is not regulated by its 3'UTR. Elife. 2021 May 6;10:e65700
• All: 1 reference(s)