About   Help   FAQ
Scn1aem1Anord
Endonuclease-mediated Allele Detail
Summary
Symbol: Scn1aem1Anord
Name: sodium channel, voltage-gated, type I, alpha; endonuclease-mediated mutation 1, Alexander S Nord
MGI ID: MGI:7437626
Synonyms: 1b-, Scn1a 1b deletion
Gene: Scn1a  Location: Chr2:66101125-66271181 bp, - strand  Genetic Position: Chr2, 39.13 cM
Alliance: Scn1aem1Anord page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified isoform(s), Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsEvolutionary conserved alternative 5' UTR-containing 1st exon 1b and associated promoter (Rr56937) were targeted with sgRNAs (targeting GGAGATCTGGGTAGTCCTCG and GCTTTTCATACTATAGTGAG) using CRISPR/Cas9 technology, resulting in a 3064 bp deletion (chr2:66237911-66240974 (GRCm39)). (J:333350)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 2 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Scn1a Mutation:  112 strains or lines available
References
Original:  J:333350 Haigh JL, et al., Deletion of a non-canonical regulatory sequence causes loss of Scn1a expression and epileptic phenotypes in mice. Genome Med. 2021 Apr 26;13(1):69
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory