Thnsl2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Thnsl2^em1(IMPC)Tcp
• Name: threonine synthase-like 2 (bacterial); endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7435547
• Gene: Thnsl2 Location: Chr6:71105150-71121364 bp, - strand Genetic Position: Chr6, 32.14 cM
• Alliance: Thnsl2^em1(IMPC)Tcp page
• IMPC: Thnsl2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCTGTGGCGGAATCTGCTGA targeting the 5' side and CCTTTAACACCGTTGTCATC targeting the 3' side flanking the critical region for an inter-exon deletion (ENSMUSE00001241758 and ENSMUSE00000458023). This resulted in a 1,234-bp deletion of Chr6 from 71,115,673 to 71,116,906 (GRCm39). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Thnsl2 Mutation: 26 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)