Lrrc38^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrrc38^em1(IMPC)Tcp
• Name: leucine rich repeat containing 38; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7435544
• Gene: Lrrc38 Location: Chr4:143076327-143097602 bp, + strand Genetic Position: Chr4, 77.55 cM
• Alliance: Lrrc38^em1(IMPC)Tcp page
• IMPC: Lrrc38 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCGCCGCAGCAGCGCCCGT targeting the 5' side and CAGCCTCAACGTGGCGGCTT targeting the 3' side within the critical region (ENSMUSE00000333235). This resulted in a 512-bp deletion of Chr4 from 143,076,771 to 143,077,282 (GRCm39). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Lrrc38 Mutation: 21 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)