Litaf^em1Chem
Endonuclease-mediated Allele Detail

Summary

• Symbol: Litaf^em1Chem
• Name: LPS-induced TN factor; endonuclease-mediated mutation 1, Manhua Chen
• MGI ID: MGI:7435335
• Gene: Litaf Location: Chr16:10777137-10810985 bp, - strand Genetic Position: Chr16, 6.28 cM, cytoband B1-B3
• Alliance: Litaf^em1Chem page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: CRISPR-cas9 mediated recombination using a single guide RNA (GCCCTGTGGCTGGTCCCGGCATAGG) created a null allele. Western blot analysis confirmed the absence of protein expression in hearts from homozygous mice. (J:317178)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Litaf Mutation: 15 strains or lines available

References

• Original: J:317178 Xiang M, et al., LITAF acts as a novel regulator for pathological cardiac hypertrophy. J Mol Cell Cardiol. 2021 Apr 3;156:82-94
• All: 1 reference(s)