Myd88^em1Skra
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myd88^em1Skra
• Name: myeloid differentiation primary response gene 88; endonuclease-mediated mutation 1, Keith Sikora
• MGI ID: MGI:7434971
• Synonyms: Myd88^S209R
• Gene: Myd88 Location: Chr9:119165000-119169084 bp, - strand Genetic Position: Chr9, 71.33 cM
• Alliance: Myd88^em1Skra page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Guide RNA (CTCAATTAGCTCGCTGGCAA), plus mutant ssDNA oligonucleotide template (GGGCACCTGTGTCTGGTCCATTGCTCGGGAGCTAATTGAGAAAAGGTTGGTTAAACATCTAAGAGGGTAGGTGGGTGAATGCATGAAACC), is designed to create a CCAGCGA to a CTCGGGA mutation, resulting in a serine to arginine substitution at position 209 (S209R) [Myd88-201: ENSMUST00000035092.7]. Three nucleotide changes were generated for murine codon optimization as well as for screening. The S209R mutation is orthologous to the S222R mutation seen in a patient with a progressively deforming arthritis characterized by marked bony overgrowth in arthritic lesions. S209R has been associated with diffuse large B cell lymphoma and severe juvenile arthritis in humans. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Myd88 Mutation: 51 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)