About   Help   FAQ
Myd88em1Skra
Endonuclease-mediated Allele Detail
Summary
Symbol: Myd88em1Skra
Name: myeloid differentiation primary response gene 88; endonuclease-mediated mutation 1, Keith Sikora
MGI ID: MGI:7434971
Synonyms: Myd88S209R
Gene: Myd88  Location: Chr9:119165000-119169084 bp, - strand  Genetic Position: Chr9, 71.33 cM
Alliance: Myd88em1Skra page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsGuide RNA (CTCAATTAGCTCGCTGGCAA), plus mutant ssDNA oligonucleotide template (GGGCACCTGTGTCTGGTCCATTGCTCGGGAGCTAATTGAGAAAAGGTTGGTTAAACATCTAAGAGGGTAGGTGGGTGAATGCATGAAACC), is designed to create a CCAGCGA to a CTCGGGA mutation, resulting in a serine to arginine substitution at position 209 (S209R) [Myd88-201: ENSMUST00000035092.7]. Three nucleotide changes were generated for murine codon optimization as well as for screening. The S209R mutation is orthologous to the S222R mutation seen in a patient with a progressively deforming arthritis characterized by marked bony overgrowth in arthritic lesions. S209R has been associated with diffuse large B cell lymphoma and severe juvenile arthritis in humans. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Myd88 Mutation:  51 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory