Gphr^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gphr^em1(IMPC)J
• Name: golgi pH regulator; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7434700
• Gene: Gphr Location: Chr3:96775630-96812662 bp, - strand Genetic Position: Chr3, 42.01 cM, cytoband F2
• Alliance: Gphr^em1(IMPC)J page
• IMPC: Gphr gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGTCACATAAGATTTACA and CCATGGGTCGTATTCAGCAT, which resulted in a 1011 bp deletion beginning at Chromosome 3 position 96,892,679 bp and ending after 96,893,689 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001216982 and ENSMUSE00001294364 (exons 4 and 5) and 802 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 44 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gphr Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)