Extl1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Extl1em1(IMPC)J |
Name: |
exostosin-like glycosyltransferase 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7434692 |
Gene: |
Extl1 Location: Chr4:134083684-134099893 bp, - strand Genetic Position: Chr4, 66.63 cM
|
Alliance: |
Extl1em1(IMPC)J page
|
IMPC: |
Extl1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAACATTCATTTCATCAGA and GACATTCCCTCAATCACAAG, which resulted in a 767 bp deletion beginning at Chromosome 4 position 134,364,315 bp and ending after 134,365,081 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001230534 and ENSMUSE00001257785 (exons 2 and 3) and 568 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 254 and early truncation 38 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|