Slc6a4^{em1(IMPC)Ccpcz}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc6a4^{em1(IMPC)Ccpcz}
• Name: solute carrier family 6 (neurotransmitter transporter, serotonin), member 4; endonuclease-mediated mutation 1, Institute of Molecular Genetics
• MGI ID: MGI:7433057
• Gene: Slc6a4 Location: Chr11:76889429-76923166 bp, + strand Genetic Position: Chr11, 46.18 cM
• Alliance: Slc6a4^{em1(IMPC)Ccpcz} page
• IMPC: Slc6a4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Czech Centre for Phenogenomics using Cas9 and guides with spacer sequences CATTGAGAATCGCTCAGGAA and GGAAATATTATTGTGGATCC that targeted exon(s) ENSMUSE00000110267.2 ENSMUSE00000110268.2. This resulted in deletion(s) of 1255 bp (location: Chr11:76903550-76904804; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc6a4 Mutation: 59 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)