About   Help   FAQ
Ect2lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ect2lem1(IMPC)J
Name: epithelial cell transforming 2 like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7432300
Gene: Ect2l  Location: Chr10:18004651-18086638 bp, - strand  Genetic Position: Chr10, 7.47 cM
Alliance: Ect2lem1(IMPC)J page
IMPC: Ect2l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACCAGGAAAAGGCTTAAA and GCTGGGTAAGTGTCTCAAGG, which resulted in a 499 bp deletion beginning at Chromosome 10 position 18,173,871 bp and ending after 18,174,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000615953 (exon 4) and 246 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 10amino acids later. There is a 4 bp insertion at the deletion site (TGAA). (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ect2l Mutation:  53 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory