About   Help   FAQ
Diras2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Diras2em1(IMPC)J
Name: DIRAS family, GTP-binding RAS-like 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7432284
Gene: Diras2  Location: Chr13:52658416-52685315 bp, - strand  Genetic Position: Chr13, 27.3 cM
Alliance: Diras2em1(IMPC)J page
IMPC: Diras2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAAGTGCGTGGTCATGTGAG and CGGAACAGAGCAACGACTAC, which resulted in a 576 bp deletion beginning at Chromosome 13 position 52,507,673 bp and ending after 52,508,248 bp (GRCm38/mm10). This mutation deletes 576 bp from ENSMUSE00000409549 (exon 2) and is predicted to cause an early termination after amino acid residue 7. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Diras2 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory