About   Help   FAQ
Myh15em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Myh15em1(IMPC)J
Name: myosin, heavy chain 15; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7431485
Gene: Myh15  Location: Chr16:48877849-49019467 bp, + strand  Genetic Position: Chr16, 30.75 cM
Alliance: Myh15em1(IMPC)J page
IMPC: Myh15 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGATCAAGAGGCAATACG and GGAGTCTCTTTAAATGACGG, which resulted in a 1220 bp deletion beginning at Chromosome 16 position 49,069,183 bp and ending after 49,070,402 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000902859, ENSMUSE00000880398 (exons 4 and 5) and 1035 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 112 and early truncation 25 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Myh15 Mutation:  83 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/14/2026
MGI 6.24
The Jackson Laboratory