Rr347^em1Prdns
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr347^em1Prdns
• Name: regulatory region 347; endonuclease-mediated mutation 1, Clare Pridans
• MGI ID: MGI:7431475
• Synonyms: Csf1r^deltaFIRE
• Gene: Rr347 Location: unknown Genetic Position: Chr18, Syntenic
• Alliance: Rr347^em1Prdns page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The super-enhancer in intron 2 of Csf1r was targeted with sgRNAs (targeting GAGTCCCTCAGTGTGTGAGAAGG and CAATGAGTCTGTACTGGAGCAGG) using CRISPR/Cas9 technology, resulting in a ~418 bp deletion including the enhancer. (J:281171)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr347 Mutation: 0 strains or lines available

References

• Original: J:281171 Rojo R, et al., Deletion of a Csf1r enhancer selectively impacts CSF1R expression and development of tissue macrophage populations. Nat Commun. 2019 Jul 19;10(1):3215
• All: 4 reference(s)