About   Help   FAQ
Gtf2a1lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gtf2a1lem1(IMPC)J
Name: general transcription factor IIA, 1-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7431467
Gene: Gtf2a1l  Location: Chr17:88976088-89022580 bp, + strand  Genetic Position: Chr17, 58.22 cM, cytoband E5
Alliance: Gtf2a1lem1(IMPC)J page
IMPC: Gtf2a1l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTACTGGCTCCATCTGAG and CACTGAGGCTGACAACCGGG, which resulted in a 406 bp deletion beginning at Chromosome 17 position 88,689,780 bp and ending after 88,690,185 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000138840 (exon 4) and 350 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 81 and early truncation 83 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gtf2a1l Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory