About   Help   FAQ
Lmnaem1Yuzha
Endonuclease-mediated Allele Detail
Summary
Symbol: Lmnaem1Yuzha
Name: lamin A; endonuclease-mediated mutation 1, Yu Zhang
MGI ID: MGI:7431464
Synonyms: LmnaG609G
Gene: Lmna  Location: Chr3:88388455-88413842 bp, - strand  Genetic Position: Chr3, 38.84 cM
Alliance: Lmnaem1Yuzha page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsThe BE4-Gam gene editing system using sgRNA GTGGGCGGATCCATCTCCTC was used to introduce a C to T change at position 1827 (c.1827C>T) resulting in a glycine to glycine substitution at codon 609 (p.G609G). This corresponds to the c.1824C>T, p.G608G dominant mutation seen in over 90% of cases with Hutchinson-Gilford progeria syndrome, which activates a cryptic splice site in exon 11 and produces a truncated laminin A which remains farnesylated. (J:332959)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lmna Mutation:  84 strains or lines available
References
Original:  J:332959 Hu Q, et al., Anti-hsa-miR-59 alleviates premature senescence associated with Hutchinson-Gilford progeria syndrome in mice. EMBO J. 2023 Jan 4;42(1):e110937
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory