Sack1hem2(IMPC)Ccpcz
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Sack1hem2(IMPC)Ccpcz |
| Name: |
scaffolding CK1 anchoring protein H; endonuclease-mediated mutation 2, Institute of Molecular Genetics |
| MGI ID: |
MGI:7431366 |
| Gene: |
Sack1h Location: Chr15:75872942-75886185 bp, - strand Genetic Position: Chr15, 35.22 cM
|
| Alliance: |
Sack1hem2(IMPC)Ccpcz page
|
| IMPC: |
Sack1h gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Deletion
|
| |
|
Mutation details:
This allele was generated at Czech Centre for Phenogenomics using Cas9 and guides with spacer sequences CTGAACCTACAATACCCATC and TAGGCACATGCTACGGCCTG that targeted exon(s) ENSMUSE00000369235.5 ENSMUSE00000414030.6 ENSMUSE00000423878.4 ENSMUSE00000423889.4 ENSMUSE00001464313.2. This resulted in deletion(s) of 4942 bp (location: Chr15:75873633-75878574; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Sack1h Mutation: |
50 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|