Ppp1r36^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppp1r36^em1(IMPC)J
• Name: protein phosphatase 1, regulatory subunit 36; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7430813
• Gene: Ppp1r36 Location: Chr12:76464312-76486266 bp, + strand Genetic Position: Chr12, 33.73 cM
• Alliance: Ppp1r36^em1(IMPC)J page
• IMPC: Ppp1r36 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACAAGCCCAGATGATCCAGC and AGTGTATCCTGAGATACACA that targeted exon(s) ENSMUSE00000449748.2 ENSMUSE00000449752.2 ENSMUSE00000449760.2 ENSMUSE00000449766.2 ENSMUSE00000449772.2 ENSMUSE00001408067.2. This resulted in deletion(s) of 10249 bp (location: Chr12:76474390-76484638; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ppp1r36 Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)