Ppp1r36em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ppp1r36em1(IMPC)J |
| Name: |
protein phosphatase 1, regulatory subunit 36; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7430813 |
| Gene: |
Ppp1r36 Location: Chr12:76464312-76486266 bp, + strand Genetic Position: Chr12, 33.73 cM
|
| Alliance: |
Ppp1r36em1(IMPC)J page
|
| IMPC: |
Ppp1r36 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, AGTGTATCCTGAGATACACA and ACAAGCCCAGATGATCCAGC, which resulted in a 10249 bp deletion beginning at Chromosome 12 position 76,427,616 bp and ending after 76,437,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000449772, ENSMUSE00000449766, ENSMUSE00000449760, ENSMUSE00000449752, and ENSMUSE00000449748 (exons 4-8) and 9807 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 9 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|