About   Help   FAQ
Ppp1r36em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ppp1r36em1(IMPC)J
Name: protein phosphatase 1, regulatory subunit 36; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7430813
Gene: Ppp1r36  Location: Chr12:76464312-76486266 bp, + strand  Genetic Position: Chr12, 33.73 cM
Alliance: Ppp1r36em1(IMPC)J page
IMPC: Ppp1r36 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, AGTGTATCCTGAGATACACA and ACAAGCCCAGATGATCCAGC, which resulted in a 10249 bp deletion beginning at Chromosome 12 position 76,427,616 bp and ending after 76,437,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000449772, ENSMUSE00000449766, ENSMUSE00000449760, ENSMUSE00000449752, and ENSMUSE00000449748 (exons 4-8) and 9807 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ppp1r36 Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory