Krtap29-1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krtap29-1^em1(IMPC)J
• Name: keratin associated protein 29-1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7430809
• Gene: Krtap29-1 Location: Chr11:99868851-99869879 bp, - strand Genetic Position: Chr11, 63.32 cM
• Alliance: Krtap29-1^em1(IMPC)J page
• IMPC: Krtap29-1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATGCCAAGCGGGCACCTA and AGGGCAACAGCTGTCTGCCA, which resulted in a 1010 bp deletion beginning at Chromosome 11 position 99,978,042 bp and ending after 99,979,051 bp (GRCm38/mm10). This mutation deletes 1010 bp from ENSMUSE00000665201 (exon 1) and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Krtap29-1 Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)