About   Help   FAQ
Krtap29-1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Krtap29-1em1(IMPC)J
Name: keratin associated protein 29-1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7430809
Gene: Krtap29-1  Location: Chr11:99868851-99869879 bp, - strand  Genetic Position: Chr11, 63.32 cM
Alliance: Krtap29-1em1(IMPC)J page
IMPC: Krtap29-1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATGCCAAGCGGGCACCTA and AGGGCAACAGCTGTCTGCCA, which resulted in a 1010 bp deletion beginning at Chromosome 11 position 99,978,042 bp and ending after 99,979,051 bp (GRCm38/mm10). This mutation deletes 1010 bp from ENSMUSE00000665201 (exon 1) and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Krtap29-1 Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory