About   Help   FAQ
Pom121l2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pom121l2em1(IMPC)J
Name: POM121 transmembrane nucleoporin like 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7430792
Gene: Pom121l2  Location: Chr13:22165364-22172904 bp, + strand  Genetic Position: Chr13, 8.11 cM
Alliance: Pom121l2em1(IMPC)J page
IMPC: Pom121l2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCAGCTACCTGGGCAAAG and CTTGTAAGTGTGATGTTTCC, which resulted in a 2881 bp deletion beginning at Chromosome 13 position 21,981,578 bp and ending after 21,984,458 bp (GRCm38/mm10). This mutation deletes 2881 bp from ENSMUSE00000378952 (exon 1) and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pom121l2 Mutation:  51 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory