Tti1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tti1em1(IMPC)J |
| Name: |
TELO2 interacting protein 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7428768 |
| Synonyms: |
Tti1- |
| Gene: |
Tti1 Location: Chr2:157823723-157870353 bp, - strand Genetic Position: Chr2, 78.68 cM
|
| Alliance: |
Tti1em1(IMPC)J page
|
| IMPC: |
Tti1 gene page |
|
Tti1em1(IMPC)J/Tti1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form typical outgrowths.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTCAGCTCAAATGCCAAG and GTATAAGAGTTGTCCTGAGG, which resulted in a 4131 bp deletion beginning at Chromosome 2 position 157,996,891 bp and ending after 158,001,021 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001259605 and ENSMUSE00001282578 (exons 3 and 4) and 3793 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 766 and early truncation 36 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|