About   Help   FAQ
Tti1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tti1em1(IMPC)J
Name: TELO2 interacting protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7428768
Synonyms: Tti1-
Gene: Tti1  Location: Chr2:157823723-157870353 bp, - strand  Genetic Position: Chr2, 78.68 cM
Alliance: Tti1em1(IMPC)J page
IMPC: Tti1 gene page
Tti1em1(IMPC)J/Tti1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form typical outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTCAGCTCAAATGCCAAG and GTATAAGAGTTGTCCTGAGG, which resulted in a 4131 bp deletion beginning at Chromosome 2 position 157,996,891 bp and ending after 158,001,021 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001259605 and ENSMUSE00001282578 (exons 3 and 4) and 3793 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 766 and early truncation 36 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tti1 Mutation:  46 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory