About   Help   FAQ
Dcp1bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dcp1bem1(IMPC)J
Name: decapping mRNA 1B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7428749
Gene: Dcp1b  Location: Chr6:119152214-119198575 bp, + strand  Genetic Position: Chr6, 56.55 cM
Alliance: Dcp1bem1(IMPC)J page
IMPC: Dcp1b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGAGCGCTTCATAACCAAG and TCTTCCTCGTGGGGATACCA, which resulted in a 2545 bp deletion beginning at Chromosome 6 position 119,198,637 bp and ending after 119,201,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254689 and ENSMUSE00001256429 (exons 4 and 5) and 2348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid residue 107. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dcp1b Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory