Dcp1bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dcp1bem1(IMPC)J |
| Name: |
decapping mRNA 1B; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7428749 |
| Gene: |
Dcp1b Location: Chr6:119152214-119198575 bp, + strand Genetic Position: Chr6, 56.55 cM
|
| Alliance: |
Dcp1bem1(IMPC)J page
|
| IMPC: |
Dcp1b gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGAGCGCTTCATAACCAAG and TCTTCCTCGTGGGGATACCA, which resulted in a 2545 bp deletion beginning at Chromosome 6 position 119,198,637 bp and ending after 119,201,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254689 and ENSMUSE00001256429 (exons 4 and 5) and 2348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid residue 107.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|