About   Help   FAQ
Arid3cem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arid3cem1(IMPC)J
Name: AT-rich interaction domain 3C; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7428738
Gene: Arid3c  Location: Chr4:41723836-41731142 bp, - strand  Genetic Position: Chr4, 22.01 cM
Alliance: Arid3cem1(IMPC)J page
IMPC: Arid3c gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATTAGTGGTGGACCCAC and GCAAGGTCTGAGCTACCTAG, which resulted in a 517 bp deletion beginning at Chromosome 4 position 41,727,825 bp and ending after 41,728,341 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000527822 (exon 3) and 444 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 103 and early truncation 3 amino acids later. There is a 13 bp insertion (ACTCATTAACCTG) at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Arid3c Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory