Pgm1^em2Laik
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pgm1^em2Laik
• Name: phosphoglucomutase 1; endonuclease-mediated mutation 2, Kent Lai
• MGI ID: MGI:7428473
• Synonyms: Pgm2^-, Pgm2^em2Laik
• Gene: Pgm1 Location: Chr4:99786648-99844491 bp, + strand Genetic Position: Chr4, 45.71 cM
• Alliance: Pgm1^em2Laik page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 mediated recombination targeting exons 2 and 3 with sgRNAs (targeting CGAGGTCTACCTTCAAGTCA and GGATGATGCAAGATACGGCA) created a 5 bp deletion mutation (CTTGA) in exon 3 resulting in a frameshift mutation at aspartic acid codon 162 (GAC) and a premature stop codon 38 nucleotides/13 codons downstream (Asp162Glufs*13). (J:322160)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pgm1 Mutation: 37 strains or lines available

References

• Original: J:322160 Balakrishnan B, et al., A novel phosphoglucomutase-deficient mouse model reveals aberrant glycosylation and early embryonic lethality. J Inherit Metab Dis. 2019 Sep;42(5):998-1007
• All: 1 reference(s)