About   Help   FAQ
Pgm1em1Laik
Endonuclease-mediated Allele Detail
Summary
Symbol: Pgm1em1Laik
Name: phosphoglucomutase 1; endonuclease-mediated mutation 1, Kent Lai
MGI ID: MGI:7428455
Synonyms: Pgm2-, Pgm2em1Laik
Gene: Pgm1  Location: Chr4:99786648-99844491 bp, + strand  Genetic Position: Chr4, 45.71 cM
Alliance: Pgm1em1Laik page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsCRISPR/Cas9 mediated recombination targeting exons 2 and 3 with sgRNAs (targeting CGAGGTCTACCTTCAAGTCA and GGATGATGCAAGATACGGCA) created an insertion (AC) and deletion (CGTA) mutation in exon 2 resulting in a frameshift mutation at valine codon 99 (GTA) and a premature stop codon 60 nucleotides/20 codons downstream (Val99Leufs*20). (J:322160)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pgm1 Mutation:  37 strains or lines available
References
Original:  J:322160 Balakrishnan B, et al., A novel phosphoglucomutase-deficient mouse model reveals aberrant glycosylation and early embryonic lethality. J Inherit Metab Dis. 2019 Sep;42(5):998-1007
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory