Pgm1^em1Laik
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pgm1^em1Laik
• Name: phosphoglucomutase 1; endonuclease-mediated mutation 1, Kent Lai
• MGI ID: MGI:7428455
• Synonyms: Pgm2^-, Pgm2^em1Laik
• Gene: Pgm1 Location: Chr4:99786648-99844491 bp, + strand Genetic Position: Chr4, 45.71 cM
• Alliance: Pgm1^em1Laik page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: CRISPR/Cas9 mediated recombination targeting exons 2 and 3 with sgRNAs (targeting CGAGGTCTACCTTCAAGTCA and GGATGATGCAAGATACGGCA) created an insertion (AC) and deletion (CGTA) mutation in exon 2 resulting in a frameshift mutation at valine codon 99 (GTA) and a premature stop codon 60 nucleotides/20 codons downstream (Val99Leufs*20). (J:322160)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pgm1 Mutation: 34 strains or lines available

References

• Original: J:322160 Balakrishnan B, et al., A novel phosphoglucomutase-deficient mouse model reveals aberrant glycosylation and early embryonic lethality. J Inherit Metab Dis. 2019 Sep;42(5):998-1007
• All: 1 reference(s)