Tbc1d4^em1Jfpw
Chemically induced Allele Detail

Summary

• Symbol: Tbc1d4^em1Jfpw
• Name: TBC1 domain family, member 4; endonuclease-mediated mutation 1, Jorgen FP Wojtaszewski
• MGI ID: MGI:7428360
• Gene: Tbc1d4 Location: Chr14:101679796-101846627 bp, - strand Genetic Position: Chr14, 50.9 cM
• Alliance: Tbc1d4^em1Jfpw page

Mutation origin

• Strain of Origin: (129S2/SvPas x C57BL/6N)F1

Mutation description

• Allele Type: Chemically induced (ENU) (Modified isoform(s))
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using gRNA GAGAAGGATGTGTGAAGGCTTGG generated a 13 bp deletion (CTTCCAAGCCTTC) resulting in a frameshift mutation in exon 11. Immunoblot analysis confirmed the complete loss of protein expression of the long isoform in skeletal and heart muscle tissue. Short isoform expression in the white adipose tissue is not affected. (J:278917)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tbc1d4 Mutation: 50 strains or lines available

References

• Original: J:278917 Kjobsted R, et al., TBC1D4 Is Necessary for Enhancing Muscle Insulin Sensitivity in Response to AICAR and Contraction. Diabetes. 2019 Sep;68(9):1756-1766
• All: 1 reference(s)