Enho^em2Smoc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Enho^em2Smoc
• Name: energy homeostasis associated; endonuclease-mediated mutation 2, Shanghai Model Organisms Center
• MGI ID: MGI:7428321
• Gene: Enho Location: Chr4:41638144-41640302 bp, - strand Genetic Position: Chr4, 21.8 cM, cytoband B1
• Alliance: Enho^em2Smoc page

Mutation origin

• Strain of Origin: C57BL/6JSmoc

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using gRNAs targeting the first intron (GGCTGTACCCACCAGTTCCG) and 3 of the coding sequence (CCCGTTTGCTCCCCAACCTA) in exon 2 deleted exon 2. (J:279085)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Enho Mutation: 9 strains or lines available

References

• Original: J:279085 Chen X, et al., Adropin protects against liver injury in nonalcoholic steatohepatitis via the Nrf2 mediated antioxidant capacity. Redox Biol. 2019 Feb;21:101068
• All: 2 reference(s)