Cenpb^em1Lamp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cenpb^em1Lamp
• Name: centromere protein B; endonuclease-mediated mutation 1, Michael A Lampson
• MGI ID: MGI:7427843
• Gene: Cenpb Location: Chr2:131019209-131021974 bp, - strand Genetic Position: Chr2, 63.29 cM
• Alliance: Cenpb^em1Lamp page

Mutation origin

• Strain of Origin: (CF-1 x (DBA/2J x C57BL/6J)F1)

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-cas9 mediated recombination created a 37 bp deletion (TGAGCACCATCCTGAAGAACAAGCGCGCCATCCTGGC) resulting in a premature stop codon at Leu100 in the DNA binding domain. (J:311052)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cenpb Mutation: 18 strains or lines available

References

• Original: J:311052 Kumon T, et al., Parallel pathways for recruiting effector proteins determine centromere drive and suppression. Cell. 2021 Sep 16;184(19):4904-4918.e11
• All: 3 reference(s)