About   Help   FAQ
Pstpip2em4Tbrd
Endonuclease-mediated Allele Detail
Summary
Symbol: Pstpip2em4Tbrd
Name: proline-serine-threonine phosphatase-interacting protein 2; endonuclease-mediated mutation 4, Tomas Brdicka
MGI ID: MGI:7427582
Synonyms: Pstpip2W232A
Gene: Pstpip2  Location: Chr18:77882250-77971462 bp, + strand  Genetic Position: Chr18, 52.38 cM, cytoband E3
Alliance: Pstpip2em4Tbrd page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/Cas9 technology, using an sgRNA (targeting ACTTCTTCCGGAATGCACTG) and an ssODN template, generated a TGG to GCA change resulting in a tryptophan to alanine substitution at amino acid 232 (p.W232A) in exon 10. This change prevents interaction with PEST phosphatases. In addition, sequence of NsiI restriction cleavage site was introduced by changing a C to T in the ATGCAC sequence. Western blot analysis indicated reduced protein levels in neutrophil lysates compared to wild-type protein levels. (J:332442)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pstpip2 Mutation:  26 strains or lines available
References
Original:  J:332442 Pavliuchenko N, et al., Molecular interactions of adaptor protein PSTPIP2 control neutrophil-mediated responses leading to autoinflammation. Front Immunol. 2022;13:1035226
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory