Pstpip2^em2Tbrd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pstpip2^em2Tbrd
• Name: proline-serine-threonine phosphatase-interacting protein 2; endonuclease-mediated mutation 2, Tomas Brdicka
• MGI ID: MGI:7427578
• Synonyms: Pstpip2^deltaC-term
• Gene: Pstpip2 Location: Chr18:77882250-77971462 bp, + strand Genetic Position: Chr18, 52.38 cM, cytoband E3
• Alliance: Pstpip2^em2Tbrd page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology, using an sgRNA (targeting AGATGATCCTGATTACTCTG) and an ssODN template, generated a 17 bp deletion (CTGTGGTTGAAGATTAC) resulting in a stop codon immediately after the first of the three tyrosines, Y323. While Y323 is preserved, the absence of the amino acids immediately following it is expected to result in a loss of SHIP1 SH2 domain binding. Western blot analysis confirmed expression of normal levels of mutant protein in neutrophil lysates. (J:332442)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pstpip2 Mutation: 26 strains or lines available

References

• Original: J:332442 Pavliuchenko N, et al., Molecular interactions of adaptor protein PSTPIP2 control neutrophil-mediated responses leading to autoinflammation. Front Immunol. 2022;13:1035226
• All: 1 reference(s)