Cd55^em1Cys
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cd55^em1Cys
• Name: CD55 molecule, decay accelerating factor for complement; endonuclease-mediated mutation 1, Jason G Cyster
• MGI ID: MGI:7427391
• Gene: Cd55 Location: Chr1:130366764-130390481 bp, - strand Genetic Position: Chr1, 56.89 cM
• Alliance: Cd55^em1Cys page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-cas9 mediated recombination using guide RNAs (CTGGCATTAGGAATGTCTGG and TCTGTCTTGAAAATGGCCAA) created a 139 bp deletion in exon 2 in the Cd55 gene. The identical sequence was also deleted in the Cd55b gene resulting in Cd55b^em1Cysi allele. (J:324874)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cd55 Mutation: 40 strains or lines available

References

• Original: J:324874 Liu D, et al., CD97 promotes spleen dendritic cell homeostasis through the mechanosensing of red blood cells. Science. 2022 Feb 11;375(6581):eabi5965
• All: 2 reference(s)