About   Help   FAQ
Adgre5em1Cys
Endonuclease-mediated Allele Detail
Summary
Symbol: Adgre5em1Cys
Name: adhesion G protein-coupled receptor E5; endonuclease-mediated mutation 1, Jason G Cyster
MGI ID: MGI:7427389
Gene: Adgre5  Location: Chr8:84449874-84467812 bp, - strand  Genetic Position: Chr8, 40.22 cM
Alliance: Adgre5em1Cys page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-cas9 mediated recombination using guide RNAs (GTAAAATGCACACCACTGCA and GAGAGTGAGAATACATGTCA) created a 940 bp deletion including all of exons 2 and 3. This allele is generated as Adgre5em2Cys allele and studied in parallel. (J:324874)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Adgre5 Mutation:  66 strains or lines available
References
Original:  J:324874 Liu D, et al., CD97 promotes spleen dendritic cell homeostasis through the mechanosensing of red blood cells. Science. 2022 Feb 11;375(6581):eabi5965
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory