Or6a2^em1Kley
Endonuclease-mediated Allele Detail

Summary

• Symbol: Or6a2^em1Kley
• Name: olfactory receptor family 6 subfamily A member 2; endonuclease-mediated mutation 1, Klaus Ley
• MGI ID: MGI:7427385
• Gene: Or6a2 Location: Chr7:106600082-106601812 bp, - strand Genetic Position: Chr7, 56.1 cM, cytoband F2
• Alliance: Or6a2^em1Kley page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-cas9 mediated recombination using a guide RNA (ATGGAGCGAAGGAACCACAC) created a 2 bp deletion (CA) in the coding region. (J:324875)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Or6a2 Mutation: 25 strains or lines available

References

• Original: J:324875 Orecchioni M, et al., Olfactory receptor 2 in vascular macrophages drives atherosclerosis by NLRP3-dependent IL-1 production. Science. 2022 Jan 14;375(6577):214-221
• All: 1 reference(s)