Vapaem1(IMPC)Kmpc
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Vapaem1(IMPC)Kmpc |
| Name: |
vesicle-associated membrane protein, associated protein A; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center |
| MGI ID: |
MGI:7426076 |
| Gene: |
Vapa Location: Chr17:65885322-65920550 bp, - strand Genetic Position: Chr17, 34.9 cM, cytoband E1.2
|
| Alliance: |
Vapaem1(IMPC)Kmpc page
|
| IMPC: |
Vapa gene page |
|
| Strain of Origin: |
C57BL/6N;C57BL/6NTac
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences AGGCATGATTCGGCTTGTTC and TTAGTGTGGTGGTATTAAAT that targeted exon(s) ENSMUSE00000138298.4. This resulted in deletion(s) of 328 bp (location: Chr17:65900259-65900586; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Vapa Mutation: |
22 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|