Ubr7em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ubr7em1(IMPC)Tcp |
| Name: |
ubiquitin protein ligase E3 component n-recognin 7 (putative); endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:7426069 |
| Gene: |
Ubr7 Location: Chr12:102724234-102743960 bp, + strand Genetic Position: Chr12, 52.19 cM, cytoband F1
|
| Alliance: |
Ubr7em1(IMPC)Tcp page
|
| IMPC: |
Ubr7 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTTCCCTCTTCCGTTATGC targeting the 5' side and GGACTGGTTGGGAGCCTACC targeting the 3' side of a critical region (ENSMUSE00000259884, ENSMUSE00000259878, ENSMUSE00000259867, ENSMUSE00000343370 & ENSMUSE00000115512) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 5,617-bp deletion of Chr12 from 102,727,155 to 102,732,771 (GRCm39) with insertion of the attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCGG).
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|