Ubr7^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ubr7^em1(IMPC)Tcp
• Name: ubiquitin protein ligase E3 component n-recognin 7 (putative); endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7426069
• Gene: Ubr7 Location: Chr12:102724234-102743960 bp, + strand Genetic Position: Chr12, 52.19 cM, cytoband F1
• Alliance: Ubr7^em1(IMPC)Tcp page
• IMPC: Ubr7 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences CCTTCCCTCTTCCGTTATGC and GGACTGGTTGGGAGCCTACC that targeted exon(s) ENSMUSE00000115512.4 ENSMUSE00000259867.4 ENSMUSE00000259878.4 ENSMUSE00000259884.4 ENSMUSE00000343370.4 ENSMUSE00001420608.2 ENSMUSE00001782589.1 ENSMUSE00001782594.1. This resulted in deletion(s) of 5617 bp (location: Chr12:102727155-102732771; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ubr7 Mutation: 52 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)