Tmem205^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem205^{em1(IMPC)Kmpc}
• Name: transmembrane protein 205; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7426040
• Gene: Tmem205 Location: Chr9:21832305-21838831 bp, - strand Genetic Position: Chr9, 7.92 cM
• Alliance: Tmem205^{em1(IMPC)Kmpc} page
• IMPC: Tmem205 gene page

Mutation origin

• Strain of Origin: Not Specified
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences AGATTGTCTAGGGTCTACTT, CAAGCCCAACCAGTCGATCT, GGAGGGCCACAAACACCGTT, and GGGACCCGGAAGCAACCTAA that targeted exon(s) ENSMUSE00000412862.4. This resulted in deletion(s) of 355 bp (location: Chr9:21837475-21837829; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem205 Mutation: 10 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)