Tmem170b^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem170b^{em1(IMPC)Kmpc}
• Name: transmembrane protein 170B; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7426038
• Gene: Tmem170b Location: Chr13:41759383-41794831 bp, + strand Genetic Position: Chr13, 20.55 cM
• Alliance: Tmem170b^{em1(IMPC)Kmpc} page
• IMPC: Tmem170b gene page

Mutation origin

• Strain of Origin: C57BL/6N;C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences ACAGAGTCCCCGGAAATGTG and CCGAACTACACTTCTGCAGC that targeted exon(s) ENSMUSE00000758864.3 ENSMUSE00000817730.2 ENSMUSE00001416772.2. This resulted in deletion(s) of 6712 bp (location: Chr13:41781413-41788124; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem170b Mutation: 4 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)