Tbc1d25^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbc1d25^em1(IMPC)Tcp
• Name: TBC1 domain family, member 25; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7426015
• Gene: Tbc1d25 Location: ChrX:8020711-8042420 bp, - strand Genetic Position: ChrX, 3.69 cM
• Alliance: Tbc1d25^em1(IMPC)Tcp page
• IMPC: Tbc1d25 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGAGCCCAGATTACAGGGCG targeting the 5' side and CATTGGGGTTGGAGCGTTGG targeting the 3' side of a critical region (ENSMUSE00001238169, ENSMUSE00001307373 & ENSMUSE00000771621) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 2,152-bp deletion of ChrX from 8,020,930 to 8,023,081 (GRCm39) with an insertion of a Bxb1 attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCTT). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tbc1d25 Mutation: 24 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)