Afg2bem1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Afg2bem1(IMPC)Bay |
| Name: |
AFG2 AAA ATPase homolog B; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:7426002 |
| Synonyms: |
Afg2b- |
| Gene: |
Afg2b Location: Chr2:122461120-122474750 bp, + strand Genetic Position: Chr2, 60.64 cM
|
| Alliance: |
Afg2bem1(IMPC)Bay page
|
| IMPC: |
Afg2b gene page |
|
Afg2bem1(IMPC)Bay/Afg2bem1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and die after 3 days in culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AAGATGGTCTTTATCAGGCA and GCCTCTGATTGACGGTCGAA that targeted exon(s) ENSMUSE00001400093.3 ENSMUSE00001405320.2 ENSMUSE00001466868.2 ENSMUSE00001467495.2 ENSMUSE00001469663.2 ENSMUSE00001472113.2 ENSMUSE00001472657.2 ENSMUSE00001473494.2. This resulted in deletion(s) of 2 bp (location: Chr2:122474922-122474923; GRCm39), 13810 bp (location: Chr2:122461062-122474871; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
4 reference(s) |
|