About   Help   FAQ
Slc25a40em1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc25a40em1(IMPC)Bay
Name: solute carrier family 25, member 40; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:7425978
Gene: Slc25a40  Location: Chr5:8472850-8504797 bp, + strand  Genetic Position: Chr5, 3.43 cM
Alliance: Slc25a40em1(IMPC)Bay page
IMPC: Slc25a40 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences GCTCCAGCCGCATTGTGCAG and TTTAAGGCTACCTGCGGGAT that targeted exon(s) ENSMUSE00000498249.2. This resulted in deletion(s) of 652 bp (location: Chr5:8480150-8480801; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc25a40 Mutation:  105 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory