Pdlim4^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pdlim4^em1(IMPC)Ics
• Name: PDZ and LIM domain 4; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:7425904
• Gene: Pdlim4 Location: Chr11:53945754-53959814 bp, - strand Genetic Position: Chr11, 32.13 cM
• Alliance: Pdlim4^em1(IMPC)Ics page
• IMPC: Pdlim4 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Institut Clinique de la Souris using Cas9 and guides with spacer sequences GACTGCACCAATGCTTAGGT, GGGAGGAGCCTTTACAATCC, GGTTGATGGGAATCTAGTGC, and TGCCAGTGTGACCAGTAGGT that targeted exon(s) ENSMUSE00001309532.2. This resulted in deletion(s) of 4 bp (location: Chr11:53954721-53954724; GRCm39), 379 bp (location: Chr11:53954286-53954664; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pdlim4 Mutation: 17 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)