Or5b112^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Or5b112^{em1(IMPC)Hmgu}
• Name: olfactory receptor family 5 subfamily B member 112; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:7425886
• Gene: Or5b112 Location: Chr19:13319124-13321692 bp, + strand Genetic Position: Chr19, 8.73 cM
• Alliance: Or5b112^{em1(IMPC)Hmgu} page
• IMPC: Or5b112 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences AAGAGTAAATAACATCCACC and CTCTAGACATGCAATGGACA that targeted exon(s) ENSMUSE00000978898.2 ENSMUSE00001381056.3 ENSMUSE00000375735.3 ENSMUSE00000461652.2 ENSMUSE00000620900.4 ENSMUSE00000693658.2 ENSMUSE00000964871.2 ENSMUSE00000975215.2 ENSMUSE00000994144.2 ENSMUSE00001012411.2 ENSMUSE00001078731.2 ENSMUSE00001376373.2 ENSMUSE00001376388.3 ENSMUSE00001376492.2 ENSMUSE00001376862.2 ENSMUSE00001377282.2 ENSMUSE00001378314.3 ENSMUSE00001378805.2 ENSMUSE00001378895.2 ENSMUSE00001379485.2 ENSMUSE00001379710.2 ENSMUSE00001379712.2 ENSMUSE00001379885.2 ENSMUSE00001380739.2 ENSMUSE00001381253.2 ENSMUSE00001381531.3 ENSMUSE00001394428.2 ENSMUSE00001395285.2 ENSMUSE00001395465.2 ENSMUSE00001395750.2 ENSMUSE00001396312.2 ENSMUSE00001397517.2 ENSMUSE00001399805.2 ENSMUSE00001400326.2 ENSMUSE00001400747.2 ENSMUSE00001401260.2 ENSMUSE00001401707.2 ENSMUSE00001402716.2 ENSMUSE00001403059.2 ENSMUSE00001405326.2 ENSMUSE00001407547.2 ENSMUSE00001408043.2 ENSMUSE00001408555.2 ENSMUSE00001409544.2 ENSMUSE00001412882.2 ENSMUSE00001462844.2. This resulted in deletion(s) of 734 bp (location: Chr19:13319200-13319933; GRCm39), 187876 bp (location: Chr19:13320033-13507908; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Or5b112 Mutation: 19 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)