Nsg2^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nsg2^{em1(IMPC)Kmpc}
• Name: neuron specific gene family member 2; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7425879
• Gene: Nsg2 Location: Chr11:31950463-32009202 bp, + strand Genetic Position: Chr11, 18.72 cM
• Alliance: Nsg2^{em1(IMPC)Kmpc} page
• IMPC: Nsg2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cpf1 and a guide with spacer sequence CAGGTGATCGTGAAGACAAG that targeted exon(s) ENSMUSE00000103168.2 ENSMUSE00000680172.2. This resulted in deletion(s) of 7 bp (location: Chr11:31967665-31967671; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nsg2 Mutation: 10 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)