Nlrp3^{em2(IMPC)Cmsu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nlrp3^{em2(IMPC)Cmsu}
• Name: NLR family, pyrin domain containing 3; endonuclease-mediated mutation 2, Cam-Su Genomic Resource Center
• MGI ID: MGI:7425870
• Gene: Nlrp3 Location: Chr11:59432395-59457781 bp, + strand Genetic Position: Chr11, 37.73 cM, cytoband B1.3
• Alliance: Nlrp3^{em2(IMPC)Cmsu} page
• IMPC: Nlrp3 gene page

Mutation origin

• Strain of Origin: C57BL/6J
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at CAM-SU Genomic Resource Center Soochow University using Cas9 and guides with spacer sequences GATGGAGAAGGCAGATCACT and GGATCTTTGCTGCGATCAAC that targeted exon(s) ENSMUSE00000677957.2. This resulted in deletion(s) of 82 bp (location: Chr11:59434084-59434165; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nlrp3 Mutation: 69 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)