About   Help   FAQ
Nlrp3em2(IMPC)Cmsu
Endonuclease-mediated Allele Detail
Summary
Symbol: Nlrp3em2(IMPC)Cmsu
Name: NLR family, pyrin domain containing 3; endonuclease-mediated mutation 2, Cam-Su Genomic Resource Center
MGI ID: MGI:7425870
Gene: Nlrp3  Location: Chr11:59432395-59457781 bp, + strand  Genetic Position: Chr11, 37.73 cM, cytoband B1.3
Alliance: Nlrp3em2(IMPC)Cmsu page
IMPC: Nlrp3 gene page
Mutation
origin
Strain of Origin:  C57BL/6J
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at CAM-SU Genomic Resource Center Soochow University using Cas9 and guides with spacer sequences GATGGAGAAGGCAGATCACT and GGATCTTTGCTGCGATCAAC that targeted exon(s) ENSMUSE00000677957.2. This resulted in deletion(s) of 82 bp (location: Chr11:59434084-59434165; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nlrp3 Mutation:  69 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory