Nek4^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nek4^{em1(IMPC)Kmpc}
• Name: NIMA (never in mitosis gene a)-related expressed kinase 4; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7425860
• Gene: Nek4 Location: Chr14:30673334-30710778 bp, + strand Genetic Position: Chr14, 19.09 cM, cytoband B
• Alliance: Nek4^{em1(IMPC)Kmpc} page
• IMPC: Nek4 gene page

Mutation origin

• Strain of Origin: C57BL/6N;C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences GCGAAGGAGGTGATCTGTAC and TCCCTCCCATGATTCTTTGT that targeted exon(s) ENSMUSE00000122061.4. This resulted in deletion(s) of 65 bp (location: Chr14:30675872-30675936; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nek4 Mutation: 38 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)