Mir490^{em1(IMPC)Mhzh}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mir490^{em1(IMPC)Mhzh}
• Name: microRNA 490; endonuclease-mediated mutation 1, Model Animal Research Centre of Nanjing University
• MGI ID: MGI:7425830
• Gene: Mir490 Location: Chr6:36398677-36398760 bp, + strand Genetic Position: Chr6, 15.48 cM
• Alliance: Mir490^{em1(IMPC)Mhzh} page
• IMPC: Mir490 gene page

Mutation origin

• Strain of Origin: C57BL/6J
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Model Animal Research Centre, Nanjing University using D10A and guides with spacer sequences AAGTTCATTGTTCGACACCA, AGCCAGGCTTCCATAAAGTG, TCTCCCAGGAAGTAAACTGG, and TTGTGAACAGCTCAACAGCA. This description was generated automatically. Additional molecular information for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mir490 Mutation: 2 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)