About   Help   FAQ
Mir29aem1(IMPC)Mhzh
Endonuclease-mediated Allele Detail
Summary
Symbol: Mir29aem1(IMPC)Mhzh
Name: microRNA 29a; endonuclease-mediated mutation 1, Model Animal Research Centre of Nanjing University
MGI ID: MGI:7425828
Gene: Mir29a  Location: Chr6:31039595-31039682 bp, - strand  Genetic Position: Chr6, 12.55 cM
Alliance: Mir29aem1(IMPC)Mhzh page
IMPC: Mir29a gene page
Mutation
origin
Strain of Origin:  C57BL/6J
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Model Animal Research Centre, Nanjing University using Cas9 and guides with spacer sequences CTGAAATCGGTTATAATGAT, CTTCAATCTGTCGTATATGT, and GACTGACCAGTCAATGTGAG. This description was generated automatically. Additional molecular information for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mir29a Mutation:  8 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory