Mia3em1(IMPC)Ccpcz
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mia3em1(IMPC)Ccpcz |
| Name: |
MIA SH3 domain ER export factor 3; endonuclease-mediated mutation 1, Institute of Molecular Genetics |
| MGI ID: |
MGI:7425824 |
| Gene: |
Mia3 Location: Chr1:183107682-183150894 bp, - strand Genetic Position: Chr1, Syntenic
|
| Alliance: |
Mia3em1(IMPC)Ccpcz page
|
| IMPC: |
Mia3 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Czech Centre for Phenogenomics using Cas9 and guides with spacer sequences CTGGGGCATTAGCTCTGCCG and TCTGTGGTGAGTATAGTAAG that targeted exon(s) ENSMUSE00000679235.2 ENSMUSE00000679236.2 ENSMUSE00001336683.2. This resulted in deletion(s) of 1154 bp (location: Chr1:183119111-183120264; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|