Megf6^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Megf6^{em1(IMPC)Kmpc}
• Name: multiple EGF-like-domains 6; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7425818
• Gene: Megf6 Location: Chr4:154255187-154360170 bp, + strand Genetic Position: Chr4, 83.89 cM
• Alliance: Megf6^{em1(IMPC)Kmpc} page
• IMPC: Megf6 gene page

Mutation origin

• Strain of Origin: Not Specified
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences ACCGTTCTCACAGGCCAAGC and GCACGTGCACTGGCCCAAGA that targeted exon(s) ENSMUSE00001264672.2. This resulted in deletion(s) of 5 bp (location: Chr4:154350702-154350706; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Megf6 Mutation: 70 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)